rs3772968 chr3:115849129 G>A
- Sequence
tacattgtgggtaagatacagaaa[G/A]ctgaaagtcctgtctattgtctaa
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.22 | -0.73 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, body mass index (bmi), chronic kidney disease, hdl cholesterol, suicide attempts in bipolar disorder, suicide attempts in mood disorder patients