rs3774933 chr4:102505182 T>C
- Sequence
tcagccaacagtttagaaaataag[T/C]tgtgcaaattgcattgctacacct
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | 2.10 | -2.44 | 1.50 | -3.93 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, height, serum creatinine, total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood