rs3776079 chr5:150148756 G>A
- Sequence
catcataggtgcccagtaaatggt[G/A]actaacaacagtatatgattactc
- ASB in cell types
- thoracic aorta coronary artery smooth muscle tibial artery
- ASB for transcription factors
- CTCF_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.73 | 0.19 | 1.25 | n/a | No Hit | |||
| JUN_HUMAN | 1.75 | -1.78 | 1.33 | -4.72 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Nerve_Tibial