rs3777772 chr6:12135201 A>G
- Sequence
ctaaccgcttaaaagtaaaaccct[A/G]tatctataccatgcaaaaacaaac
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | -1.05 | 1.68 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, hip bone mineral density (bmd), homa-b, homa-ir, ldl cholesterol, schizophrenia, total cholesterol, triglycerides