rs378108 chr21:39097594 A>G
- Sequence
ctttttcagaagatgacctttggc[A/G]aaaaaacaatttgttccttttcct
- ASB in cell types
- CD14+ monocytes liver
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.91 | -1.55 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, age at death with kuru exposure, ankylosing spondylitis, ankylosing spondylitis (hla-b27 negative), ankylosing spondylitis (hla-b27 positive), biploar disorder (bipolar schizoaffective disorder), bipolar disorder in alcoholics, childhood acute lymphoblastic leukemia, graves disease, irritible bowel syndrome, ldl cholesterol change with statins, response to lithium treatment for bipolar disorder, spine bone mineral density (bmd)
PheWAS abnormal findings on study of brain, nervous system, absent or infrequent menstruation, adverse effects of insulins and antidiabetic agents, allergic conjunctivitis, anomalies of pupillary function, atrial fibrillation, atrial fibrillation & flutter, atrophy of edentulous alveolar ridge, attention deficit hyperactivity disorder, calcium/phosphorus disorders, cancer of the lower gi tract, chronic ulcer of unspecified site, colles fracture, colorectal cancer, conductive hearing loss, cystitis and urethritis, disorders of lipoid metabolism, disturbance of skin sensation, disturbances in tooth eruption, disturbances of sensation of smell and taste, ectropion or entropion, first degree av block, functional digestive disorders, glaucoma, gross hematuria, hallux rigidus, hemangioma and lymphangioma, any site, hemorrhage in early pregnancy, hypercholesterolemia, hyperlipidemia, infection/inflammation of internal prosthetic device, implant or graft, lipoid metabolism disorder nos, localized superficial swelling, mass, or lump, lung disease due to external agents, lyme disease, macular puckering of retina, malignant neoplasm of kidney and other urinary organs, obsessive-compulsive disorder, open-angle glaucoma, osteoarthrosis of multiple sites, other congenital anomalies of skin, other disorders of bladder, other headache syndromes, other specified disorders of liver, ovarian dysfunction, paroxysmal supraventricular tachycardia, pathological, developmental or recurrent dislocation, pneumoconiosis, polyarthropathy or polyarthritis involving multiple sites nos, primary thrombocytopenia, prurigo, pseudomonal pneumonia, rash and other nonspecific skin eruption, renal dialysis, respiratory abnormalities, rheumatoid arthritis, rheumatoid arthritis & related inflammatory polyarthropathies, sciatica, spinal stenosis of lumbar region, spirochetal infection, spondylolisthesis, congenital, spondylosis and allied disorders, supraventricular premature beats, thyrotoxicosis, uterine/uterovaginal prolapse