rs3781907 chr11:74005424 A>G
- Sequence
agctccacctctggggcaacccct[A/G]ccacatcctgcctgtggtgtagct
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MGAP_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MGAP_HUMAN | 3.08 | n/a | 2.00 | n/a | n/a | |||
| ARI1B_HUMAN | 2.26 | -2.10 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, alzheimers disease, hypertension (early onset hypertension), infant head circumference, schizophrenia, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Lung, Nerve_Tibial, Testis, Thyroid