rs378303 chr19:6633235 A>G
- Sequence
ggataactgcgggcgagcctgact[A/G]atgtcaggtcctccacaagaggtg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZN143_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN143_HUMAN | 1.52 | -1.27 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1