rs378809 chr9:4657863 G>C
- Sequence
attggtggcatctgtttggtaaat[G/C]actctagttttactgtttacattg
- ASB in cell types
- HepG2 (hepatoblastoma) ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.68 | 0.29 | 1.29 | |||
| ZR-75-1 (invasive ductal carcinoma) | 2.18 | -1.64 | 2.00 |
Items per page:
1 – 2 of 2