rs3788116 chr21:44302559 C>T
- Sequence
ccttcctagaaaggctgaccctgg[C/T]cgaggggaagcctgtggcatagtg
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.33 | -0.72 | 1.44 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, asthma, birth weight, fasting insulin, homa-ir, hypertension (early onset hypertension), schizophrenia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood