rs3788551 chr22:39356522 A>T
- Sequence
ccatgtggggagtcccacatgagc[A/T]gcgtgtgcaaagctgttgggcggg
- ASB in cell types
- NCI-H2171 (small cell lung carcinoma)
- ASB for transcription factors
- MAX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAX_HUMAN | -1.93 | 1.70 | 1.42 | n/a | No Hit |
Items per page:
1 – 1 of 1