rs3791661 chr2:55902735 A>C
- Sequence
gaaccagctggttttttgcttctg[A/C]gtcattaattctattataatcaca
- ASB in cell types
- HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | 1.46 | -1.17 | 1.33 |
Items per page:
1 – 1 of 1