rs3792252 chr2:27773064 G>A
- Sequence
ggccatgtgtctggagctcactac[G/A]ggaatccagaagaacaaactctgc
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | n/a | 1.81 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), fasting blood glucose, hypertension (early onset hypertension), infant head circumference, irritible bowel syndrome, ldl cholesterol, lp-pla2 activity, major depressive disorder, serum creatinine, spine bone mineral density (bmd), total cholesterol, triglycerides
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid