rs379527 chr19:6676431 C>A
- Sequence
gtaggtgagaatgtgggcaagaac[C/A]caagaaaatacctagaaaagcatg
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.04 | -0.52 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, asthma, cystatin c in serum, ldl cholesterol, maternal transmission distortion, primary rhegmatogenous retinal detachment, transmission distortion