rs37972 chr7:7967878 T>C
- Sequence
tcttgaaaattaatgaaagttatc[T/C]gatgaagatccttacattaattgc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.25 | 0.52 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, college completion, height, infant head circumference, primary rhegmatogenous retinal detachment, response to inhaled glucocorticoids for asthma measured as change in forced expiratory volume (fev1), serum creatinine, total cholesterol change with statins, years of education