rs3801385 chr7:121337489 T>C
- Sequence
gtaagtggaatttaaactgtgagg[T/C]ttttcctttctttggtgagattac
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.49 | -2.88 | 2.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diastolic blood pressure (dbp), hdl cholesterol, hdl cholesterol change with statins, hip bone mineral density (bmd), mitral annular calcium, premature ovarian failure, serum creatinine, systolic blood pressure (sbp), total body bone mineral density (bmd)