rs3807148 chr7:138738989 G>C
- Sequence
catgtgttgtatctcctcaaaacc[G/C]ctttatatctacaggctgcgagga
- ASB in cell types
- GM12878 (female B-cells) HeLa Kyoto (cervical adenocarcinoma) SK-N-SH (neuroblastoma) erythroid cells
- ASB for transcription factors
- RAD21_HUMAN ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.25 | 0.24 | 1.56 | n/a | n/a | |||
| ZNF24_HUMAN | 2.32 | 0.91 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, ldl cholesterol change with statins, total cholesterol change with statins, triglycerides