rs3809858 chr17:47189846 A>C
- Sequence
agacataggatagcttctgtcttc[A/C]aggagattaaggtctatttaaggg
- ASB in cell types
- GM12878 (female B-cells) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.57 | 0.43 | 1.29 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.82 | 0.19 | 1.52 |
Items per page:
1 – 2 of 2