rs3812062 chr5:126776591 C>A
- Sequence
ctattacgtaattccacagcgtcc[C/A]ggcctccaggccgtttcccgagcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.28 | 0.96 | 2.57 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hypertension (early onset hypertension), irritible bowel syndrome, parkinsons disease