rs3813639 chr1:179081343 T>C
- Sequence
tgctcagtcccagcacttgaaagt[T/C]gcaaacctagtcaagaaagtgcac
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.51 | 0.28 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, major depressive disorder, microalbuminuria
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Nucleus_accumbens_basal_ganglia, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood