rs3814815 chr14:24232826 G>T
- Sequence
caaggtggtctttggtcaactgcc[G/T]cctggaccaaggcaacaggaagtg
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.48 | n/a | 2.50 | n/a | No Hit | |||
| ZFX_HUMAN | -0.98 | 1.75 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood