rs381499 chr5:173615647 C>A
- Sequence
gactgaccaatggcattaggatct[C/A]aactaggcaccaaatctcctttta
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.21 | 0.68 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.66 | 0.63 | 2.57 |
Items per page:
1 – 2 of 2