rs3822585 chr5:157479978 A>G
- Sequence
atatgaccccaatggccatgcccc[A/G]agtctactctggtcacactcctga
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | -0.73 | 1.16 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol change with statins, mitral annular calcium, parkinsons disease, serum creatinine, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood