rs3826464 chr17:9154592 G>A
- Sequence
caggtgtgggcgggagttaggtgt[G/A]tgggcagctggagttgctccaccc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFHX2_HUMAN | 2.14 | -2.76 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, hdl cholesterol, hypertension (early onset hypertension), late onset alzheimers disease, resistance to kuru in aged women despite likely exposure, sporadic creutzfeldt-jakob disease