rs3829861 chr10:84139503 T>A
- Sequence
tatttacgtcctttcgatgttgcg[T/A]catgcagtgcgccggaggaactgt
- ASB in cell types
- coronary artery smooth muscle H1 (embryonic stem cells) neutrophils foreskin keratinocyte
- ASB for transcription factors
- JUN_HUMAN CREB1_HUMAN JUND_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 2.17 | -2.07 | 1.33 | n/a | No Hit | |||
| CREB1_HUMAN | 1.51 | -1.79 | 1.33 | -5.85 | Concordant | |||
| JUND_HUMAN | 2.15 | -1.84 | 1.33 | n/a | No Hit | |||
| CTCF_HUMAN | 1.47 | 1.18 | 1.83 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood