rs383915 chr5:151316163 T>C
- Sequence
tgtggacagtcttagctggctgca[T/C]ctcctttggccagttgctgccact
- ASB in cell types
- K562 (myelogenous leukemia) T47D (invasive ductal carcinoma) GM12878 (female B-cells) liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.89 | -0.28 | 1.99 | |||
| T47D (invasive ductal carcinoma) | 1.94 | -1.18 | 2.00 | |||
| GM12878 (female B-cells) | 0.28 | 0.49 | 1.26 | |||
| liver | -1.48 | 1.24 | 1.92 | |||
| CD34+ stem cells-derived erythroblasts | -3.18 | 2.09 | 2.50 |
Items per page:
1 – 5 of 7