rs383971 chr1:229217843 C>G
- Sequence
agagacccagggaagagcagggga[C/G]tttagcaaacatgggactgtcact
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.01 | -0.49 | 3.76 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Colon_Sigmoid, Minor_Salivary_Gland, Prostate, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid