rs384490 chr11:3057655 T>G
- Sequence
acaagcactaaagactgagcgtcc[T/G]gtaataggtgtttaagtcatgatt
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma)
- ASB for transcription factors
- MNT_HUMAN IKZF1_HUMAN ETV1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 0.04 | 1.87 | 2.00 | n/a | n/a | |||
| IKZF1_HUMAN | -0.90 | 1.84 | 2.00 | n/a | No Hit | |||
| ETV1_HUMAN | -3.03 | 2.20 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, barnes akathisia rating scale, birth weight, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, microalbuminuria, obesity with early age of onset (age >2), prop taste detection threshold, tardive dyskinesia, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood