rs384545 chr7:134138097 C>T
- Sequence
atgactcagccagtcaggcaataa[C/T]atacagggagcaccctgtatgcat
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.02 | 0.50 | 1.52 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, fasting insulin, hdl cholesterol, hdl cholesterol change with statins, height, ldl cholesterol change with statins, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid