rs384605 chr19:39079150 A>G
- Sequence
aggagtttgaggtcacagtgagct[A/G]tgattgcatgattacaccaatgca
- ASB in cell types
- A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.04 | -0.31 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.60 | 1.00 | 2.19 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg