rs384642 chr1:91165534 T>C
- Sequence
ggagggaatttgtaacagcactca[T/C]gatgggatttttactattttagtt
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.84 | 2.67 | |||
| HEK293 (embryonic kidney) | -0.16 | 0.68 | 1.97 |
Items per page:
1 – 2 of 2