rs3848595 chr19:33144001 G>C
- Sequence
attgtctgggtccacagggatggg[G/C]tcgtgcttctaaatgcccagtgtg
- ASB in cell types
- A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- SMC3_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 1.08 | 0.41 | 1.47 | n/a | n/a | |||
| RAD21_HUMAN | 0.74 | 0.55 | 1.56 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, diastolic blood pressure (dbp), total cholesterol change with statins, triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Colon_Sigmoid, Liver, Muscle_Skeletal, Nerve_Tibial