rs3851179 chr11:86157598 T>C
- Sequence
ccatataatagttgtgatagataa[T/C]atttactgaagtgtgtattgtttg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.61 | -0.13 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI alzheimers disease, alzheimers disease in apoe e4- carriers, family history of alzheimers disease
GRASP adiponectin levels, alzheimers disease, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), body mass index (bmi), late onset alzheimers disease, late onset alzheimers disease (disease progression), mean bilateral hippocampal volume (excluding patients with neuropsychiatric disorders), mean entorhinal cortical thickness, parkinsons disease, triglycerides
PheWAS acidosis, adverse effects of antirheumatics, allergic reaction to food, anaphylactic shock nos, angina pectoris, anxiety disorder, astigmatism, attention deficit hyperactivity disorder, bone cancer, bronchiectasis, cancer of bone & connective tissue, cancer of connective tissue, cancer of larynx, cancer of oropharynx, cancer of the upper aerodigestive tract, cancer, suspected or other, carbohydrate transport and metabolism disorder, cardiac arrest, cardiac arrest & ventricular fibrillation, cardiac complications, not elsewhere classified, chronic hepatitis, congenital anomalies of face and neck, decubitus ulcer, diseases of spleen, disorders of refraction and accommodation, disorders of uterus, nec, disorders of vitreous body, dupuytrens disease, generalized anxiety disorder, genu valgum or varum (acquired), hammer toe, hematuria, hx of malignant neoplasm of oral cavity and pharynx, hyposmolality and/or hyponatremia, idiopathic fibrosing alveolitis, impacted cerumen, intervertebral disc disorders, intestinal infection due to c. difficile, ischemic heart disease, liver replaced by transplant, malignant neoplasm, other, muscle weakness, muscle/tendon sprain, myopia, neoplasm of uncertain behavior, noninflammatory disorders of ovary, fallopian tube, & broad ligament, noninflammatory disorders of vagina, noninflammatory female genital disorders, orchitis and epididymitis, other abnormal blood chemistry, other alveolar and parietoalveolar pneumonopathy, other dermatoses, other diseases of respiratory system, other disorders of tympanic membrane, other signs and symptoms in breast, other specified diseases of sebaceous glands, paralysis/spasm of vocal cords or larynx, perforation of tympanic membrane, pervasive developmental disorders, pneumoconiosis, postoperative infection, proteinuria, prurigo, psoriatic arthropathy, seborrheic keratosis, spondylosis and allied disorders, spondylosis without myelopathy, stiffness of joint, swelling, mass, or lump in head and neck, thoracic neuritis/radiculitis, urinary tract infection, varicose veins, varicose veins of lower extremity, varicose veins of lower extremity, symptomtic, viral hepatitis, viral pneumonia