rs385209 chr10:117544545 T>C
- Sequence
aaaaggagtaattagtttacggat[T/C]ggagtcagtaaaagacctacctcc
- ASB in cell types
- H1 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H1 (embryonic stem cells) | 1.13 | -0.00 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, hdl cholesterol, refractive error, spine bone mineral density (bmd), total cholesterol