rs3856765 chr3:102084208 G>A
- Sequence
tttgcaggctctaggaagggttgc[G/A]tcacacatggcaatccatcatttt
- ASB in cell types
- SUM159PT (pleiomorphic breast carcinoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 1.32 | 0.08 | 1.33 | 0.88 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, college completion, irritible bowel syndrome, major depressive disorder, triglycerides