rs385715 chr4:2793927 T>C
- Sequence
ctctgggcctcggctccctggggg[T/C]attgagggcctgagccctgctgtg
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.91 | -0.32 | 2.01 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.21 | 0.91 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Sun_Exposed_Lower_leg, Whole_Blood