rs3858205 chr10:21364887 A>G
- Sequence
gtgtctcttgacgaggtgcatggg[A/G]aagtccgctgcatcaccaaaaaag
- ASB in cell types
- A549 (lung carcinoma) HAEC (human aortic endothelial cells)
- ASB for transcription factors
- JUN_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | -0.45 | 1.00 | 2.00 | n/a | No Hit | |||
| TF65_HUMAN | 1.60 | -0.60 | 2.00 | -1.42 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP body mass index (bmi), comorbid depressive syndrome and alcohol dependence, hdl cholesterol, height, obesity with early age of onset (age >2)