rs3858747 chr13:20943749 C>A
- Sequence
ttggccaccaggtggctcccaccc[C/A]cagccttttctagaaggatccatt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte erythroid progenitors epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.21 | 0.64 | 2.26 | |||
| foreskin keratinocyte | n/a | 0.34 | 2.67 | |||
| erythroid progenitors | n/a | 2.62 | 2.50 | |||
| epidermal keratinocytes | 1.61 | 0.88 | 2.00 |
Items per page:
1 – 4 of 4