rs3862468 chr16:11100161 G>C
- Sequence
gaacttgcctctgtgcatcaagct[G/C]aagaaggtgcaggagtttcagagc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.59 | -0.18 | 1.40 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP homa-b, infant head circumference, multiple sclerosis severity scale (continuous), multiple sclerosis severity scale (extreme), multiple sclerosis severity scale (median)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid