rs386901 chr19:12294737 T>C
- Sequence
cccgggtcctcccaactcccgtag[T/C]cagggtaggtcccagcgcgacaaa
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.95 | -0.16 | 1.99 | |||
| HepG2 (hepatoblastoma) | 0.41 | 0.45 | 1.25 | |||
| GM12878 (female B-cells) | 0.56 | 0.57 | 1.26 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood