rs388286 chr20:56890368 C>T
- Sequence
ttaactgagagggtctagaagcaa[C/T]gtcaccttgatatcaacaagtaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN NFIB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.17 | 2.22 | 3.66 | 2.87 | Concordant | |||
| NFIB_HUMAN | -1.41 | 1.86 | 2.75 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP bipolar disorder and schizophrenia, hypertension (early onset hypertension), testicular dysgenesis syndrome, testicular dysgenesis syndrome (cryptorchidism subphenotype), testicular dysgenesis syndrome (testicular germ cell cancer subphenotype)