rs388484 chr19:17215758 A>T
- Sequence
gcccccccgactcccatgatcagg[A/T]catgggaaagacccccgggtgaca
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.89 | -0.21 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, obesity with early age of onset (age >2)
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Uterus, Whole_Blood