rs3889808 chr10:79195483 G>A
- Sequence
caggccgacagtgatctgttgggc[G/A]ggagcccggcctctccggctatag
- ASB in cell types
- breast tumor tissue VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor tissue | 1.78 | n/a | 2.50 | |||
| VCaP (prostate carcinoma) | 1.86 | n/a | 2.00 |
Items per page:
1 – 2 of 2