rs389409 chr1:32650943 C>T
- Sequence
tcaagaaaatggctgccctcttgc[C/T]gcgggagtgtgcggaccaaacctc
- ASB in cell types
- foreskin keratinocyte CD14+ monocytes gastroesophageal sphincter
- ASB for transcription factors
- CTCF_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.06 | 1.44 | 1.34 | 0.00 | Weak Discordant | |||
| STAT1_HUMAN | n/a | 2.60 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
