rs392809 chr1:76146317 A>G
- Sequence
ccttaacttctctcccttcataaa[A/G]ggaagattatcccttttttaattc
- ASB in cell types
- D341 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 1.68 | -1.71 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, body mass index (bmi), college completion, comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), mitral annular calcium, neuroblastoma (brain cancer), parkinsons disease, paternal transmission distortion, transmission distortion