rs392844 chr19:16182726 G>T
- Sequence
ggtctccatctcctgacctcgtga[G/T]ccgcccgcctcggcctcccaaagt
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.76 | -0.00 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.76 | 1.16 | 2.56 | |||
| GM12878 (female B-cells) | 1.41 | -1.29 | 1.33 | |||
| neural progenitors | 1.64 | n/a | 1.33 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis