rs3934674 chr4:47011121 A>G
- Sequence
gttgcagtttcaatggtagatgaa[A/G]ttcaaaggtcaaagtacctaaaaa
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 0.94 | -0.72 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), bipolar disorder, college completion, major depressive disorder, rheumatoid arthritis, rheumatoid arthritis, gender differentiated, systolic blood pressure (sbp), triglycerides change with statins