rs393559 chr19:39078742 G>C
- Sequence
aagagtccagtaaaaataacgtca[G/C]actgtggtatgaccgtgattcagc
- ASB in cell types
- A549 (lung carcinoma) HAEC (human aortic endothelial cells)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.36 | -0.05 | 1.71 | n/a | No Hit |
Items per page:
1 – 1 of 1