rs39452 chr7:25093790 T>C
- Sequence
ctagttaaaattttatctcatgca[T/C]tagtcaaaatgcaaatctttaggc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.73 | -0.21 | 1.96 | |||
| GM12878 (female B-cells) | 0.12 | 0.69 | 1.31 | |||
| PC9 (lung adenocarcinoma) | n/a | 1.87 | 4.00 |
Items per page:
1 – 3 of 3