rs395601 chr15:58770997 G>C
- Sequence
aagccgcacacaagggagctgccc[G/C]ggagttcaacttccggccacatag
- ASB in cell types
- thymus-derived CD34- cells
- ASB for transcription factors
- BC11B_HUMAN BCL3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BC11B_HUMAN | n/a | 2.00 | 2.50 | n/a | n/a | |||
| BCL3_HUMAN | 0.70 | 0.02 | 1.10 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), diastolic blood pressure (dbp), hdl cholesterol, hdl cholesterol change with statins, infant head circumference, ldl cholesterol, triglycerides
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood