rs395908 chr19:44870308 G>A
- Sequence
cactattctaacagcttggagggc[G/A]gccaggaggatgtggggaggcttg
- ASB in cell types
- HEK293 (embryonic kidney) monocyte-derived macrophages
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.68 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism with verbal ability, college completion, hdl cholesterol, ldl cholesterol, ldl cholesterol response to statins, ldl cholesterol response to statins (first post-treatment ldl cholesterol), total cholesterol, triglycerides, years of education